Frequently Asked Questions


CUGI offers the following primers for reaction with your samples.
Primer Name Sequence Direction Abbreviation appended to sequence name
T3 AATTAACCCTCACTAAAGGG 5' -> 3' (forward) T3
T7 TAATACGACTCACTATAGGG 5' -> 3' (forward) T7
Sp6 GCTATTTAGGTGACACTATAG 5' -> 3' (forward) Sp6
M13R GGAAACAGCTATGACCATG 3' -> 5' (reverse) M13R
M13F GTAAAACGACGGCCAG 5' -> 3' (forward) M13F
pIndigoBACF GGATGTGCTGCAAGGCGATTAAGTTGG 5' -> 3' (forward) pIBF
pIndigoBACR CTCGTATGTTGTGTGGAATTGTGAGC 3' -> 5' (reverse) pIBR
T7terminator GCTAGTTATTGCTCAGCGG 5' -> 3' (forward) T7t

Our online sequencing worksheet will allow you to specify your own primers. You must provide your primer name, the primer concentration and the melting temperature for your primer. Be sure to send your custom primer with your samples.

  • For High copy sequencing, CUGI uses 1pmol of primer per reaction. If you add primer yourself, add .5µl of 2pmol stock to resuspended template or 1pmols and dry down. If you send an aliquot for CUGI to add send 10µM stock.
  • For Low copy sequencing, CUGI uses 50pmol per reaction. If you add primer yourself, add 1ul of 50pmol stock to resuspended template or 50pmols and dry down. If you send an aliquot for CUGI to add send 50µM stock.

The online sequencing worksheet will allow that you provide your own sample and plate names for the samples you send. Be sure to clearly label plates as well as any samples sent in tubes. Our instrumentation requires that sample and plate names be kept simple. Names can contain the following characters: alphanumeric, dashes, underscores and periods. Names must be 15 characters or less.

Dried down samples are completely dried or lypholized. Resuspended samples should be in no more than 3µl.

CUGI operates in 96-well format. It is optimal to send 96-well plates, but tubes are accepted in no more than 48 per order. Please ship samples to arrive on Tuesday through Friday. No weekend deliveries

Please use the guide when preparing samples for sequencing

  • High Copy Plasmids Bacterial Culture: Please grow an overnight culture in 96-well format in LB+15% glycerol. Seal plate with a clear plate sealer (not foil type), freeze to -80C and ship on dry ice
  • Low Copy Plasmids Bacterial Culture: Please grow an overnight culture in 96-well format in LB+15% glycerol. Seal plate with a clear plate sealer (not foil type), freeze to -80C and ship on dry ice
  • Purified High Copy Plasmids: Please send purified plasmid DNA at a concentration of 30-50ng either dried down or resuspended within 3µl
  • Purified Low Copy Plasmids: Please send purified plasmid DNA at a concentration of 150-200ng either dried down or resuspended within 5µl
  • Purified PCR Products: Samples must be purified of unincorporated nucleotides and residual primers. RULE OF THUMB: For each kb of fragment size send approximately 10ng either dried down or resuspended within 3µl of ddH20.
  • Ready to Load Samples: Send samples dried down in 96-well format. CUGI will resuspend in HiDi, denature, and load on ABI sequencer

CUGI uses copy number information to determine the quantity of sequencing reagents and template concentration needed for a sequencing reaction.

High copy refers to a high copy number of plasmids per cell (>300) and PCR amplicons. Typically, high copy plasmids contain inserts 10kb in size or less. Examples of high copy plasmids are pGEM, TOPO, pBlueskript, etc. Low copy refers to a low copy number of plasmids per cell (1-20). Typically, these are BACs, fosmids, and some expression vectors.

On-Campus Customers please drop off during the following times on the 3rd floor across from spiral staircase

Monday-Friday 9:00-9:30am
Monday-Thursday 2:30-3:00pm

Off-Campus Customers please ship to:

Clemson University Genomics Institute
CUGI Sequencing Center BRC 310
51 New Cherry Street
Clemson, SC 29634

For Windows Users:
The easiest way for you to access your FTP account is to use your "My Computer" window ( not a web browser).
Click on the 'My Computer' icon. In the address bar type the link provided in results e-mail ftp://username:password@ftp.genome.clemson.edu .

Internet Explorer version 7 will not work for using password protected FTP accounts. Version 6 will work fine.

Mozilla Firefox requires you to simply cut and paste your FTP link into the address bar.

http://www.7-zip.org/ is a free utility that you can use to open your files.