| Primer Name | Sequence | Direction | Abbreviation appended to sequence name |
|---|---|---|---|
| T3 | AATTAACCCTCACTAAAGGG | 5' -> 3' (forward) | T3 |
| T7 | TAATACGACTCACTATAGGG | 5' -> 3' (forward) | T7 |
| Sp6 | GCTATTTAGGTGACACTATAG | 5' -> 3' (forward) | Sp6 |
| M13R | GGAAACAGCTATGACCATG | 3' -> 5' (reverse) | M13R |
| M13F | GTAAAACGACGGCCAG | 5' -> 3' (forward) | M13F |
| pIndigoBACF | GGATGTGCTGCAAGGCGATTAAGTTGG | 5' -> 3' (forward) | pIBF |
| pIndigoBACR | CTCGTATGTTGTGTGGAATTGTGAGC | 3' -> 5' (reverse) | pIBR |
| T7terminator | GCTAGTTATTGCTCAGCGG | 5' -> 3' (forward) | T7t |
Our online sequencing worksheet will allow you to specify your own primers. You must provide your primer name, the primer concentration and the melting temperature for your primer. Be sure to send your custom primer with your samples.
The online sequencing worksheet will allow that you provide your own sample and plate names for the samples you send. Be sure to clearly label plates as well as any samples sent in tubes. Our instrumentation requires that sample and plate names be kept simple. Names can contain the following characters: alphanumeric, dashes, underscores and periods. Names must be 15 characters or less.
Dried down samples are completely dried or lypholized. Resuspended samples should be in no more than 3µl.
CUGI operates in 96-well format. It is optimal to send 96-well plates, but tubes are accepted in no more than 48 per order. Please ship samples to arrive on Tuesday through Friday. No weekend deliveries
Please use the guide when preparing samples for sequencing
CUGI uses copy number information to determine the quantity of sequencing reagents and template concentration needed for a sequencing reaction.
High copy refers to a high copy number of plasmids per cell (>300) and PCR amplicons. Typically, high copy plasmids contain inserts 10kb in size or less. Examples of high copy plasmids are pGEM, TOPO, pBlueskript, etc. Low copy refers to a low copy number of plasmids per cell (1-20). Typically, these are BACs, fosmids, and some expression vectors.
On-Campus Customers please drop off during the following times on the 3rd floor across from spiral staircase
Monday-Friday 9:00-9:30am
Monday-Thursday 2:30-3:00pm
Off-Campus Customers please ship to:
Clemson University Genomics Institute
CUGI Sequencing Center BRC 310
51 New Cherry Street
Clemson, SC 29634
For Windows Users:
The easiest way for you to access your FTP account is to use your "My Computer" window ( not a web browser).
Click on the 'My Computer' icon. In the address bar type the link provided in results e-mail ftp://username:password@ftp.genome.clemson.edu .
Internet Explorer version 7 will not work for using password protected FTP accounts. Version 6 will work fine.
Mozilla Firefox requires you to simply cut and paste your FTP link into the address bar.
http://www.7-zip.org/ is a free utility that you can use to open your files.